Place Order

Data Interpretation Assignment

 

The question

Background

In this module we have considered how we can modify plants to produce recombinant proteins for us. One important group of therapeutic proteins which have been produced in this way are antibodies. In devising this question about recombinant antibody production, we have used information from a variety of sources, and made some data up or re-used published information – so please be wary of trying to find the precise data presented to you – it may not exist, or may not be the same as you expect! The principles and theory, however, are all real and based on topics covered in the module.

You should refer to the module content to help you answer these questions, and may use other sources including texts, journals and reputable resources to help formulate your answers.

Some examples of resources that may help you understand some of the techniques discussed in this assignment are:

Remember that the University regulations on plagiarism and collusion apply – your written answers must be your own work, written in your own words, and referenced as appropriate. Please submit your answers as a Word document to the dropbox.

Please create a word document to answer these questions. You may have to draw graphs or diagrams (these can be inserted into the word document).  If you need to do these on paper, you can scan/image them and insert them to the submitted work. Ensure your tables and diagrams are labelled appropriately.

Remember that the University regulations on plagiarism and collusion apply – your written answers must be your own work, written in your own words, and referenced as appropriate. Please submit your answers as a Word document to the dropbox by the deadline set.

 

Question 1

You are setting up an investigation to optimise the transformation of E. coli with a plasmid and transgene to generate a genetically modified plant that will produce a recombinant antibody that can then be used as a therapeutic tool.

You obtain a plasmid to clone a large number of copies of a particular recombinant antibody DNA fragment. (pABC and pXYZ). The recombinant plasmids have an ampicillin-resistant gene. These plasmids were next introduced via transformation into a laboratory bacterial strain. The recombinant bacteria were next inoculated into different Luria-Bertani agar plates (LB):  I) LB + Ampicillin, II) LB + Ampicillin + kanamycin and III) LB plate.

Below is your plate set up for the investigation:

 

 

1a) What are the 3 key components of a cloning vector (3 marks)

 

1b) What is the purpose of each agar plate labelled A-D (4 marks)

 

1c) What is your prediction for E. coli growth on each of the plates labelled A-D
(4 marks)

 

 

Question 2

The E. coli have been allowed to grow overnight at 37⁰C, and you obtain the results from the following plates:

2)  What would you have summarised if there had been growth on Plate B and no growth on Plate A? (4 marks)

 

In recent work, scientists have used binary vectors in Agrobacterium tumefaciens to introduce cDNAs coding for the heavy and light chains of a mouse antibody with potential for therapeutic use in breast cancer into tobacco plants.  We will call the antibody produced in plants Ap.  The native antibody made by the mouse line is denoted Am.

To prepare the cDNA coding for the light chain immunoglobulin subunits, total RNA was extracted from murine hybridoma cells producing the antibody of interest. This cDNA contains sequences for all the genes being expressed in the cells.  To amplify the specific sequences required (those coding for the immunoglobulin chains), PCR was used.
Fig 1 below shows part of the nucleotide sequence including the 5’ and 3’ sequence of a light chain.

 

 

 

5’ – CGAGAGCCACGGGCGATTTATCCGGGTACTTTCGATCCCATTACCAATGGTCA TATCGATATCGTGACGCGCGCCACGCAGATGTTCGATCACGTTATTCTGGCGATTGCCG CCAGCCCCAGTAAAAAACCGATGTTTACCCTGGAAGAGCGTGTGGCACTGGCACAG CAGGCAACCGCGCATCTGGGGAACGTGGAAGTGGTCGGGTTTAGTGATTTAATGGC GAACTTCGCCCGTAAT…………………..….CAACACGCTACGGTGCTGATTCGTGGCCTG
CGTGCGGTGGCAGATTTTGAATATGAAATGCAGCTGGCGCATATGAATCGCCACTTA
ATGCCGGAACTGGAAAGTGTGTTTCTGATGCCGTCGAAAGAGTGGTCGTTTATCTC
TTCATCGTTGGTGAAAGAGGTGGCGCGCCATCAGGGCGATGTCACCCATTTCCTGCC
GGAGAATGTCCATCAGGCGCTGATGGCGAAGTAGCGT – 3’

Fig 1: Part of the nucleotide sequence encoding an immunoglobulin light chain.

It was decided to clone the gene into an expression vector using the restriction enzymes PaeR7I (for 5′-end) and XbaI (for 3′-end).

The design of both primers are shown below:

5’- GCTCGAGAGCCACGGGCGATTTATCC -3’                  Forward Primer

5’- CTCTAGAACGCTACTTCGCCATCAGC -3’                            Reverse Primer

 

Question 3

3a) Using an online tools/resource, identify the recognition sequences for each of the restriction enzymes (XbaI and PaeR7I).
Find which enzyme cuts each primer above and highlight the recognition sequence within each primer. (4 marks)

 

3b) Identify the location (annealing sites) of the two primers on the cDNA sequence shown in Fig 1. Clearly show the complementary DNA strand, the alignment and primer orientation. Include a diagram to help illustrate your answer (8 marks).

 

 

To perform a PCR, you plan to use the protocol below to make a PCR cocktail. You are provided with 10 ml of each primer at a concentration of 10µM, as well as sufficient volume of 10X buffer, 10mM dNTPs, template DNA, Taq DNA polymerase, and Nuclease-free water (see table below).

Question 4

4) You are required to make a 50µl reaction, with 2µl of DNA template. Calculate the volume of each primer to add to the reaction cocktail to give a final concentration of 0.5 mM and the volume of nuclease free water you need to make a final volume of 50 ml?  (6 marks)

 

This approach was also adopted to clone the light and heavy chains of the therapeutic antibody. To prepare the cDNA coding for the light and heavy chain immunoglobulin subunits, total RNA was extracted from murine hybridoma cells producing the antibody of interest. This cDNA contains sequences for all the genes being expressed in the cells.  To amplify the specific sequences required (those coding for the immunoglobulin chains), PCR was used. Fig 2 shows the sequences of the primers used to amplify each of the cDNAs.

Light chain Forward primer:

5’ GCGGCCGCTATGGTACAGGTCTTTGCGGATG 3’

Light chain Reverse primer:

5’ TGTCGACGGTGGTGCATTTCGTACTTCGGTCA 3’

Heavy chain Forward primer:

5’ AGGATCCTTCACAGCAGATGGCAGACTCAGTCAA 3’

Heavy chain Reverse primer:

5’ GGAAAGCTTCCTACAGCTCATCCTTGCAACTCAGA 3’

Fig 2: PCR primers for amplification of light and heavy chain cDNAs

 

To allow the amplified sequences to be cloned, each of the primers in Fig 2 contains a single unique restriction enzyme recognition site. The enzymes which recognise the primers are SalI, HindIII, KpnI, and NotI.

Question 5

5) Find the recognition sequences for each of these enzymes (SalI, KpnI, HindIII, and NotI), and identify which enzyme cuts each primer in Fig 2.
Highlight the recognition sequence on each primer. (5 marks)

 

In addition, to target the proteins produced from the cloned cDNA, a sequence referred to as KDEL has been incorporated into the Heavy Chain Reverse Primer.  KDEL is the single letter amino acid code for a sequence (Lysine-Aspartate-Glutamate-Leucine) which targets proteins containing it to the endoplasmic reticulum, and the “KDEL sequence” in the Heavy Chain Reverse Primer codes for it. This targeting is useful to ensure glycosylation of proteins.

 

Question 6

6) Using Heavy Chain Reverse primer sequence, identify the complementary annealing sequence and the transcribed mRNA sequence relating to the primer.

Using the codon catalogue above, identify the possible KDEL sequence and highlight it on the relevant part of the primer sequence.  (6 marks)

 

An expression plasmid was used to produce large quantities of a desired antibody protein. The gene encoding the protein is inserted into the plasmid. It can then be transcribed and translated by a host organism. The key parts of the expression plasmid and their roles are listed below. The elements of the expression cassette in between the right (RB) and left border (LB) sequence of T-DNA are shown below.

 

 

 

HC – cDNA of the heavy immunoglobulin chain of Am

TAA – Stop codon

35ST– transcriptional terminator sequences from cauliflower mosaic virus

 

35SPro – cauliflower mosaic virus 35S promoter containing duplicated enhancer sequences

RBS – Ribosome binding site

ATG – Start codon

KDEL – endoplasmic reticulum retention signal sequence

 

Question 7

7) Rearrange the elements above between the RB and LB in the diagram above to produce a functioning expression cassette which would allow the expression of the heavy chain polypeptide  (7 marks)

 

Plant binary vectors were introduced into Agrobacterium tumefaciens, which was then used to transform tobacco plants (Nicotiana tabacum L). The transgenic plants were selected on an appropriate antibiotic containing medium. To assess the expression of each antibody fragment Northern blot analysis was performed using total RNA isolated from 5 transgenic plant leaf tissues. The blots were hybridized with a 32P-labeled random-primed heavy chain or light chain gene fragments, respectively (Figure 4).

Fig. 4. Northern blot analyses of transgenic tobacco plants.
(a) Northern blot analysis of transgenic plants expressing the heavy chain gene of the antibody. Lane N, transgenic plant transformed with vector (pBIN-H) alone. Lanes 1–5, transgenic plants expressing the heavy chain gene. Upper panel – heavy chain probe hybridisation, Lower panel – ethidium bromide stained rRNA
(b) Northern blot analysis of transgenic plants expressing the light chain gene of the antibody. Lane N, transgenic plant transformed with vector (pBIN-G) alone. Lanes 1–5, transgenic plants expressing the light chain gene. Upper panel – light chain probe hybridisation, Lower panel – ethidium bromide stained rRNA

Question 8

8a) What is the purpose of the ethidium bromide stained rRNA in the lower panel in Fig 4a and b.    (3 marks)? 

8b) What is the purpose of Lane N, transgenic plant transformed with the respective vector    (3 marks)

8c) What do the data in Figs 1 a and b indicate concerning the expression of the light and heavy chain construct in the recombinant plants?
(3 marks)

 

 

Question 9

A cation exchange column has been set up. This type of column uses negatively charged beads.

The column is equilibrated at pH 5.0 and a crude mixture of the light (protein A) and heavy chain (protein B) immunoglobulins were passed through the column.

Protein A = Immunoglobulin light chain

Protein B = Immunoglobulin heavy chain

The elution buffers used are at pH 8.0 and then pH 6.0.

The pI (isoelectric point) values for each protein are shown in the diagram below.

9) Complete the table below to identify whether you would expect each protein to be either eluted, and at which pH, or remain bound to the column (4 marks).

 

Protein A Bound / Eluted Bound / Eluted Yes / No
Protein B Bound / Eluted Bound / Eluted Yes / No

 

 

 

The vector was introduced into Agrobacterium tumefaciens, which was then used to infect tobacco leaf explants.  Four transformed explants were regenerated, leaves were harvested, and total protein extracted.

To see if any of the transformed plants were expressing the antibody, Western blotting of the extracts was carried out following SDS-PAGE separation.  The blot was probed with anti-mouse heavy chain and anti-mouse light chain antibodies linked to horseradish peroxidase.  The results are shown in Fig 5.

 

 

 

 

 

Fig 5: Western blot analysis of protein extracts from leaves of plants transformed with Am
Arrows indicate the top of the gel and the position of the solvent front. Numbers along the left hand edge indicate the size of the proteins used in the marker lane, 1.  Lanes 2 to 4 contain protein extracted from separate transformed plants (Ap).

Question 10

10a) Comment on the results obtained in Fig 5.  (6 marks)

 

10b) Calculate the sizes of the heavy and light chains in the extracts from lanes 2, 3
and 4.
To calculate this, produce a graph of Rf value against the log of the size the molecular weight standards in lane 1. You can then accurately determine the size of heavy and light chains from each extracts using their Rf values.   (10 marks)

 

The next step was to select to one of these extracts and check the antibody activity.

The lane 2 extract was chosen and labelled Ap . It was tested to see whether it was able to bind with high affinity to its antigen. To test this the researchers carried out immunofluorescence staining (Fig 6) and ELISAs (Table 2), using a range of cancer cell lines which either expressed the antigen or not. The results are shown below.

 

 

Fig 6 Immunofluorescence staining of antigen expressing cells using the recombinant plant antibody (Ap). Blue staining represents DAPI staining, red staining represents AP staining.

Table 2.  Specific binding of Ap and Am to antigen-expressing cells

Cell line Absorbance at 490 nm following incubation with:
Ap Am TPE Buffer
HAdC 0.214 0.211 0.186 0.118
HMa 0.209 0.119 0.184 0.104
HBrC 1.225 1.044 0.197 0.106
HCrC 1.242 1.177 0.192 0.117

Cell extracts generated from different carcinoma cell lines were incubated in an ELISA format with antibodies as shown and positive interactions are denoted by absorbance at 490 nm. Absorbance Values are shown along with standard deviations. Am represents a commercially available antibody that recognises and binds the antigen that is the target for the Ap antibody

HAdC – Human adenocarcinoma line extract

HMa – Human melanoma line extract

HBrC – Human breast cancer line  extract  expressing the antigen targeted by the antibody Am

HCrC – Human colorectal carcinoma line extract expressing the antigen targeted by the antibody Am

TPE – total protein extract from non-transgenic tobacco plant leaves.

Buffer – Reagent buffer used in the ELISA assay

 

Question 11

11) Discuss the results from the Immunofluorescence staining and ELISA assays shown in Fig 6 and Table 2, respectively. Refer to the reactivity obtained with the cell lines and the reactivity obtained from the different antibodies and reagents tested. What do the results indicate about Ap?    (10 marks)

The recombinant plant antibody was purified and its activity compared to that of Am.  Initially, its affinity was checked by ELISA and results are shown in Fig 7.

Subsequently, the ability of the antibody to kill colorectal cancer cells was compared to a commercial antibody, Am.  Results are shown in Fig 8.

It is interesting to consider the biological activity of recombinant antibodies – as that is the main purpose of producing many of them.  Ap produced as described in the early part of this question was compared to Am in its ability to inhibit the in vivo growth of colorectal tumours injected into nude mice (nude mice being immunodeficient and a good model for growth of tumours).  Fig 9 shows the effect of injection of Ap on tumour volume in nude mice compared to that of Am.  You can see that they differ significantly.

Fig 9.  Effects of Ap and Am on Colorectal Tumour Volume in Nude Mice.
Tumour growth suppression in nude mice by Ap.  BALB_cnu_nu mice were inoculated with colorectal cancer cells and one dose (100 µg) of Ap or Am.  The control group received a melanoma-specific murine antibody, ME3.61.  All mice were injected with further doses of each antibody every 3 days for a total dose of 400 µg. Arrows indicate the days of treatment.  Tumour volumes were recorded at 10, 15, 21, 25, 28, 32, and 35 days after initial inoculation with cancer cells.  Data are given as mean + SD.

Question 12

12) Considering the data in Figs 7-9, evaluate the results from each figure and discuss the quality of the recombinant antibody (Ap) compared to the commercial antibody, Am. Comment on any aspects which you think could affect recombinant plant-produced antibody activity, and suggest further experiments or approaches to investigate this.  (10 marks)

End of Assessment

 

Data Interpretation Assignment (BIOL40322 SpTopBiotechnology)